{"id":139267,"date":"2018-07-02T20:00:47","date_gmt":"2018-07-03T00:00:47","guid":{"rendered":"https:\/\/today.uconn.edu\/?p=139267"},"modified":"2018-07-03T11:03:10","modified_gmt":"2018-07-03T15:03:10","slug":"scientists-crack-koalas-genetic-code","status":"publish","type":"post","link":"https:\/\/today.uconn.edu\/2018\/07\/scientists-crack-koalas-genetic-code\/","title":{"rendered":"Scientists Crack Koala&#8217;s Genetic Code"},"content":{"rendered":"<p>An international team of scientists including UConn genomicist Rachel O\u2019Neill have sequenced the first full koala genome, they report today in <a href=\"https:\/\/www.nature.com\/articles\/s41588-018-0153-5\"><em>Nature<\/em> <em>Genetics<\/em><\/a>. The koala\u2019s genes have already revealed some of the furry tree dweller\u2019s secrets, from how it digests toxic eucalyptus leaves to why it\u2019s susceptible to chlamydia.<\/p>\n<p>Koalas are marsupials, along with kangaroos, wombats, Tasmanian devils, and opossums. Marsupials give birth when their young are still very small and underdeveloped, and then raise the babies in a pouch for several additional months. They diverged from other mammals a very long time ago, and scientists have suspected that the marsupial genome could answer many questions about how early mammals evolved.<\/p>\n<p>&#8220;Koalas are an iconic marsupial mammal,&#8221; says O&#8217;Neill, professor of molecular and cell biology. &#8220;Everyone knows what a koala looks like, which makes it a great species to use as an educational tool. But they are at risk due to population crashes in the distant past and an emerging infectious virus.&#8221;<\/p>\n<p>Figuring out their genome \u2013 spelling out all the genes and which chromosome, or DNA molecule, each gene is on \u2013 gives biologists the opportunity to identify genes related to the koala&#8217;s response to viruses, and identify boundaries of population diversity that can direct conservation efforts, she says. O&#8217;Neill, director of UConn&#8217;s <a href=\"https:\/\/isg.uconn.edu\/\">Systems Genomics Institute<\/a>, specializes in marsupials, and was also involved in the first marsupial genome ever sequenced\u00a0\u2013\u00a0<a href=\"https:\/\/today.uconn.edu\/2011\/08\/what-makes-a-kangaroo-a-kangaroo\/\">the tammar wallaby<\/a>.<\/p>\n<aside class=\"grey-sidebar floating-sidebar col-xs-12 col-sm-4\">\n<p style=\"font-family: 'Proxima Nova',sans-serif; !important;font-size: 14px; font-weight: 400;\">Genome sequencing is the spelling out of all the DNA of a living organism like a human, koala, or pine tree. DNA is made up of nucleotides, little molecules that we represent as A, C, G or T. When a genome is sequenced, it looks like a long string of those letters: ACCCGGGTTACACTGACTGA \u2026.<\/p>\n<p style=\"font-family: 'Proxima Nova',sans-serif; !important;font-size: 14px; font-weight: 400;\">To sequence a genome, a researcher first gets a bunch of DNA from the organism she\u2019s interested in. She then makes lots of copies of it, and then chops the DNA up into short strands. She then reads each short strand, and by comparing the pieces, tries to figure out how the original strand was put together. The technique depends on the likelihood that the DNA copies weren\u2019t all chopped up into exactly the same pieces. <a href=\"https:\/\/today.uconn.edu\/2015\/10\/a-better-way-to-read-the-genome\/\">UConn researchers are working on a better way to read DNA<\/a>, but for right now, it\u2019s still a tear-and-compare slog.<\/p>\n<p style=\"font-family: 'Proxima Nova',sans-serif; !important;font-size: 14px; font-weight: 400;\">And once the genome is spelled out, it\u2019s still a code that needs to be deciphered, a foreign language only vaguely related to sister languages that themselves we don\u2019t fully understand.<\/p>\n<p style=\"font-family: 'Proxima Nova',sans-serif; !important;font-size: 14px; font-weight: 400;\">For example, the koala genome is spelled out using 3.4 billion nucleotides that make 26,000 genes. Imagine a string of ACGTACTTATA &#8230; 3.4 billion characters long. A 150 page-long paperback would have only 150,000 letters that spell out about 45,000 words.<\/p>\n<p style=\"font-family: 'Proxima Nova',sans-serif; !important;font-size: 14px; font-weight: 400;\">You can see from the comparison that either the average gene is longer than the average word, or there\u2019s a lot of nucleotides in there that don\u2019t spell out genes. The answer is yes, to both. Just because we\u2019ve decoded the spelling of the koala\u2019s DNA doesn\u2019t mean we know what every gene does, or even what every gene is: that\u2019s a harder problem than just decoding the letters. But often geneticists know what genes for, say, milk proteins look like in other animals, and can look for similar genes in a new genome, like that of the koala. A lot of gene identification is guesswork.<\/p>\n<\/aside>\n<p>The koala genome that has just been published is the most complete marsupial genome sequenced to date, on par with the human genome. The consortium of scientists\u00a0\u2013\u00a054 researchers from 29 different institutions across seven countries\u00a0\u2013 sequenced more than 26,000 genes in the koala genome, making it slightly larger than the human one. And in one way, says O&#8217;Neill, the koala genome is actually better than the human one: the koala genome has had its centromeres defined. Think of the centromere as the spot where the two halves of each chromosome are attached; if you imagine the &#8216;X&#8217; chromosome, the centromere is at the cross of the X. It&#8217;s a special part of the genome that helps the DNA copy itself.<\/p>\n<p>\u201cThis is the first full genome assembly in any animal to contain centromeres that have been functionally defined,\u201d O&#8217;Neill says. Compared to a human&#8217;s, the koala centromeres are small, disordered, and full of &#8216;jumping genes&#8217;, pieces of DNA that can move around within the genome.<\/p>\n<p>Several unusual patterns in the koala genome have already answered questions about the koala that have puzzled people for decades.<\/p>\n<p>For example, koalas live in eucalyptus forests in Australia and subsist almost entirely upon eucalyptus leaves, which contain poisonous compounds that make other mammals sick if eaten in large amounts. Researchers from the Earlham Institute in the UK noticed that the koala genome has a greater number and diversity of genes known to code for metabolic enzymes in the liver that help break down toxins like those found in eucalyptus leaves.<\/p>\n<p>Another important discovery was the composition of koala milk. Because koala babies (called joeys) are born at such an early stage of development \u2013 just 5 weeks gestation, compared to the 9 weeks for dogs or 40 weeks for humans \u2013 they need very different types and amounts of milk as they grow and suckle inside their mother\u2019s pouch.<\/p>\n<p>\u201cThanks to the high-quality genome, the team was able to analyze and discover koala-specific milk proteins that are critical for various stages of development, says the University of Sydney&#8217;s Katherine Belov, one of the lead authors on the study. It also appears these proteins may have an antimicrobial role, showing activity against a range of bacterial and fungal species, including <em>Chlamydia pecorum<\/em>, the strain known to cause blindness and infertility in koalas.<\/p>\n<p>Chlamydia has severely reduced koala populations in New South Wales and Queensland. Using information gained from the koala genome, scientists hope to develop a vaccine.<\/p>\n<p>\u201cThe genome enables a holistic and scientifically grounded approach to koala conservation,&#8221; says Rebecca Johnson, director of the Australian Museum Research Institute and another lead author.<\/p>\n<p>Wild koalas are currently found in eucalyptus forest and woodlands across Eastern Australia (Victoria, New South Wales, and Queensland), and have been translocated to other sites, such as south eastern South Australia and onto some islands.<\/p>\n<p>Their unique and highly specific diet of eucalyptus tree leaves has resulted in koalas being especially vulnerable to habitat loss due to the clearing of native vegetation for agriculture and urban development. The Australian federal government lists koala populations in Queensland, New South Wales, and Australian Capital Territory as \u2018vulnerable\u2019 under national environment law. The research team hopes that findings from the koala genome will help efforts to conserve and protect the species.<\/p>\n<p>&nbsp;<\/p>\n","protected":false},"excerpt":{"rendered":"<p>UConn is part of an international team that has sequenced the first full koala genome, helping to explain how it digests toxic eucalyptus leaves and why it is susceptible to chlamydia.<\/p>\n","protected":false},"author":79,"featured_media":139338,"comment_status":"closed","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"_acf_changed":false,"wds_primary_category":0,"wds_primary_series":0,"wds_primary_attribution":0,"footnotes":""},"categories":[2226,2076,2225],"tags":[],"magazine-issues":[],"coauthors":[1899],"class_list":["post-139267","post","type-post","status-publish","format-standard","has-post-thumbnail","hentry","category-clas","category-research","category-uconn-storrs"],"pp_statuses_selecting_workflow":false,"pp_workflow_action":"current","pp_status_selection":"publish","acf":[],"publishpress_future_action":{"enabled":false,"date":"2026-08-04 09:39:58","action":"change-status","newStatus":"draft","terms":[],"taxonomy":"category","extraData":[]},"publishpress_future_workflow_manual_trigger":{"enabledWorkflows":[]},"_links":{"self":[{"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/posts\/139267","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/users\/79"}],"replies":[{"embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/comments?post=139267"}],"version-history":[{"count":16,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/posts\/139267\/revisions"}],"predecessor-version":[{"id":139340,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/posts\/139267\/revisions\/139340"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/media\/139338"}],"wp:attachment":[{"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/media?parent=139267"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/categories?post=139267"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/tags?post=139267"},{"taxonomy":"magazine-issue","embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/magazine-issues?post=139267"},{"taxonomy":"author","embeddable":true,"href":"https:\/\/today.uconn.edu\/wp-rest\/wp\/v2\/coauthors?post=139267"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}